Y2r biography, Y2r discography
Nastech Pharmaceuticals, Bothell, WA and *UCLA, Los Angeles, CA.Endpoints: LDH Assay, MTT Assay, TEER, TER
Materials Tested: Peptide YYSummary:
Peptide YY (PYY) was identified in the 1980s as a hormone produced in the gut and as early as 1993 it was demonstrated that peripheral administration of PYY was a satiety factor in mammals and could thus be a potential treatment for obesity.Subsequent research has identified that PYY is released in proportion to the calorie content of a meal.To accomplish this, a primary human epithelial cell model (EpiAirway, MatTek, Inc.Drug formulations were placed on the apical side of the tissue layer, and drug quantitation carried out for the basal media.The extent of tight junction opening was measured by decrease in the transepithelial electrical resistance (TEER).Cell viability and cytotoxicity were monitored by MTT and LDH assays, respectively.There was a substantial decrease in TEER for several formulations tested, indicating tight junction opening.The decrease in TEER has been shown to correlate with the permeation of drug across the cell layer.Using all the available data, a multivariate analysis was conducted to elucidate the effect each formulation component exerted on each of the 7 output variables (drug permeability, osmolality, stability at refrigerated and
accelerated conditions, TEER, and MTT and LDH assays).Related material:PubMed recordPubMed related artsPubMed LinkOutGeneGEO ProfilesNucleotideProteinPubMed articles by: Ma, L.Copyright notice and DisclaimerVariations in Peptide YY and Y2 Receptor Genes Are Associated With Severe Obesity in Pima Indian MenLijun Ma, P.Infante, Sayuko Kobes, Clifton Bogardus, and Leslie J.BaierFrom the Diabetes Molecular Genetics Section, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Department of Health and Human Services, Phoenix, Arizona.Address correspondence and reprint requests to Leslie J.Baier, PhD, Diabetes Molecular Genetics Section, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, 4212 North 16th St.The publisher's final edited version of this article is available free at Diabetes.AbstractPeptide YY (PYY) and Y2 receptor (Y2R) may be important in the central regulation of body weight and food intake.Sequencing of PYY identified three single nucleotide polymorphsms (SNPs) in the untranslated region.Sequencing of the Y2R coding region identified one missense (Ala172Thr) substitution and two silent substitutions.Y2R were identified from public databases.It has been suggested that PYY plays a role in the development of obesity in rodents, but this remains controversial.Mice lacking the Y2R gene have increased body weight, food intake, and fat deposition (8).Y2R pathway plays a role in human obesity.PYY concentrations were decreased in obese compared with lean subjects (10).In addition, two synonymous amino acid substitutions have been identified in Y2R that are associated with obesity in British Caucasian men (11).The Pima Indians of Arizona have a high prevalence of severe obesity, and BMI in this population is highly heritable (12,13).American population, PYY and Y2R were analyzed as obesity candidate genes.The human PYY gene (NCBI accession no.These two variants were in complete genotypic concordance among the 83 subjects and had a major allele frequency of 0.Pima Indians (Table 2) for association analysis.TABLE 3Association of PYY and Y2R gene SNPs with severe obesity under logistic regression analysesThe human Y2R gene (NCBI accession no.Three variants were detected by sequencing the coding region of Y2R in the same 83 extremely obese subjects described above (Table 1).Y2R was used to determine the haplotype structure of this gene (Fig.SNP9, the only coding missense substitution identified in Y2R, which was physically located in the third block, had a minor allele frequency that was too low for confident assignment to any haplotype block.SNPs identified in Y2R gene.However, a recent study by Hung et al.Therefore, it is possible that PYY or Y2R, or a different gene in the pathway that is activated by their interaction, is hormonally controlled.PYY and Y2R to obesity in women.Further genetic analysis of PYY and Y2R in other populations should help clarify the biological importance of these genes in the development of severe human obesity.The 83 obese subjects who were used for sequence analysis were part of the 362 obese subjects who were genotyped for association studies.Sequence variant identification and genotypingGenomic DNA for sequencing and genotyping was obtained from peripheral lymphocytes.Sequence analysis of PYY included the entire four exons and three introns (1.Sequence analysis of Y2R included only the coding region.Variants identified by direct sequencing or by searching databases were genotyped in DNA from 489 subjects using the TaqMan Allelic Discrimination Assay (Applied BioSystems).ABI Prism 7700 (Applied BioSystems).Sequence information for all oligonucleotide primers and probes is available upon request.Differences of genotype frequencies were assessed with logistic regression between the lean and obese groups.For logistic regression modeling in the additive model, homozygotes for the major allele (aa) and heterozygotes (ab) and homozygotes for the minor allele (bb) were coded to a continuous numeric variable for genotype (0, 1, and 2).Product terms were used to assess the interaction between genotype and sex.HaploView was used to place SNPs in haplotype blocks.Batterham RL, Cowley MA, Small CJ, Herzog H, Cohen MA, Dakin CL, Wren AM, Brynes AE, Low MJ, Ghatei MA, Cone RD, Bloom SR.In Program of the 75th Annual Meeting of the Endocrine Society, 1993, Las Vegas, NV.Challis BG, Pinnock SB, Coll AP, Carter RN, Dickson SL, O'Rahilly S.Grandt D, Schimiczek M, Rascher W, Feth F, Shively J, Lee TD, Davis MT, Reeve JR Jr, Michel MC.To eat or not to eat: how the gut talks to the brain.Naveilhan P, Hassani H, Canals JM, Ekstrand AJ, Larefalk A, Chhajlani V, Arenas E, Gedda K, Svensson L, Thoren P, Ernfors P.Hung CC, Pirie F, Luan J, Lank E, Motala A, Yeo GS, Keogh JM, Wareham NJ, O'Rahilly S, Farooqi IS.Myb expression in human disease.Mattevi VS, Zembrzuski VM, Hutz MH.Ridderstrale M, Carlsson E, Klannemark M, Cederberg A, Kosters C, Tornqvist H, Storgaard H, Vaag A, Enerback S, Groop L.Related material:PubMed recordPubMed related artsPubMed LinkOutSubstanceTaxonomyTaxonomy treePubMed articles by: Zhang, X.Histology, Karolinska Institute, 171 77, Stockholm, Sweden.Tomas HokfeltAccepted November 18, 1996.AbstractThe Y2 subtype of neuropeptide tyrosine (NPY) receptors (Y2R) and some neuropeptides have been studied with in situ hybridization in sensory and autonomic neurons of rat and monkey.DRG) neuron profiles (NPs) contain Y2R mRNA in the rat and monkey.In monkey DRGs Y2R mRNA is expressed mainly in small neurons.Y2R in small and large DRG neurons in both species.Y2R and NPY mRNAs are colocalized in many large neurons in axotomized rat DRGs.Y2R mRNA is detected in a few NPs in normal rat superior cervical ganglia, with a marked increase after transection of the carotid nerves.Finally, Y2R mRNA levels increase in rat spinal motoneurons after axotomy.DRG, superior cervical ganglion, and nodose ganglion neurons and as presynaptic receptors in monkey DRG neurons.Neuropeptide tyrosine (NPY), isolated from bovine brain by Tatemoto et al.Two major subtypes were early recognized, the Y1 and the Y2 receptors (Y1Rs, Y2Rs) that were considered to represent primarily postjunctional and prejunctional receptors, respectively (6, 7).DRG) neurons NPY is under normal circumstances undetectable, or present at very low levels (15).Y2R binding on sensory neurons is increased after peripheral axotomy (Axo) (18).Moreover, after peripheral Axo, Y1R mRNA levels decreased in small but increased in large DRG neurons (21).In the present study we have used in situ hybridization to analyze the expression and regulation of Y2R mRNA both in rat and monkey DRGs, and in rat superior cervical ganglia (SCGs), NGs, and sphenopalatine ganglia (SPGs) under normal conditions and after Axo (DRGs in rat and monkey, and SCGs and NGs in rat).Eighteen rats were deeply anesthetized, and the left internal and external carotid nerves were transected 2 mm away from the SCGs.The rats were sacrificed after 2, 7, or 14 days (six in each group).The experiments on rats had been approved by Stockholms norra djurforsoksetiska namnd (a local ethical committee), and on monkeys by the Chinese National Committee to the Use of Experimental Animals for Medical Purposes, Shaanxi branch.Preparation of Probes and Hybridization Procedure.Scandinavian Gene Synthesis, Koping, Sweden) were used: (i) TGCTTGGAGATCTTGCTCTCCAGGTGGTAGACAATGCAAC, (ii) TGTGCCTTCGCTGATGGTAATGGTCACTTGCAGCTCCAGGAC, and (iii) GAGTTTGTACTCCTTCAGGTCCAGGACATGGCTGTCGA complementary to nucleotide sequences of the intracellular loops 2 and 3, and extracellular loop 3 of the rat Y2R, respectively (25).ATP (New England Nuclear) and purified as described (21).The in situ hybridization procedure followed published protocols (21).The size of NPs in the DRGs, the intensity of labeling of the Y2R mRNA in DRGs, and the intensity of labeling of NPY mRNA in SCGs were measured as described (21) using National Institutes of Health image software (courtesy W.The size of 200 NPs containing Y2R mRNA and 400 NPs with or without Y2R mRNA from both control and ipsilateral DRGs of the rats and the monkeys 14 days after unilateral Axo were measured.The relative density levels of labeling of Y2R mRNA in DRGs of three control and three axotomized (14 days) animals, and of NPY mRNAs in SCGs of three control and three axotomized (7 days) rats were measured.Each image was digitized with 256 gray levels for each picture element.After Axo there was a strong increase in the percentage of Y2R mRNA + NPs in ipsilateral DRGs (Figs.NPs were positive, with a small decrease on the contralateral side (Fig.Figure 2Percentage of Y2R mRNA + NPs in control, ipsilateral, and contralateral DRGs of the rats 2, 7, 14, and 21 days (a) after and of monkeys 14 days after sciatic nerve cut (d).Size range of Y2R mRNA + NPs in rat (b) and monkey (e) control DRGs (more ...NPs were Y2R mRNA + (Figs.After Axo there was a shift toward larger Y2R mRNA + NPs (Fig.Only single Y1R mRNA + NPs could be observed in normal and axotomized DRGs (data not shown).Fewer NPs expressed Y2R plus SP mRNA than Y2R plus CGRP mRNA (12.NPY mRNA + NPs contained Y2R mRNA (Fig.Occasionally, Y2R and Y1R mRNA could be observed in the same NPs (2.Y2R mRNA was expressed in 0.Two days after transection of internal and external carotid nerves, the number of Y2R mRNA + NPs was markedly increased ipsilaterally (Figs.NPs 7 days after Axo (Figs.SPGs (o) of rats, hybridized with (more ...Figure 4Percentage of Y2R mRNA + and NPY mRNA + NPs (a), and gray levels of NPY mRNA labeling (b) in SCGs of control rats and in ipsilateral and contralateral SCGs 2, 7, and 14 after unilateral carotid nerve cut.Percentage of Y2R mRNA + (more ...NPs contained NPY mRNA (Figs.NPs in ipsilateral SCGs (Fig.NPs expressed Y2 mRNA (Fig.After sciatic cut a marked increase in the number of Y2R mRNA + motoneuron profiles was seen ipsilaterally at all time intervals studied (Figs.Axo shows Y2R mRNA + motoneurons (arrowheads).However, this probe showed a signal in several brain areas, including hippocampus.NPs, express detectable Y2R mRNA levels under normal circumstances in agreement with a preliminary report by Gustafsson et al.In the SCG, a primarily noradrenergic sympathetic ganglion, the Y2R levels are under normal circumstance very low.No Y2R mRNA signal is detected in the normal, parasympathetic SPG.DRG NPs are Y2R mRNA +, but the vast majority is small.It should be emphasized that our methodology may not be sensitive enough to detect low levels of Y2R mRNA, and that we therefore underestimate the occurrence of Y2Rs.Competition experiments indicated that this binding mainly represents a Y2R.The present and previous results show that CGRP neurons can be subdivided into two complementary subpopulations, small CGRP neuron expressing the Y1R (21) and large CGRP neurons expressing Y2 mRNA (present data).Thus, after Axo, Y2Rs may act as autoreceptors on primary afferents in the dorsal horn, in addition to being activated by NPY released from local dorsal horn neurons (14).NPY has been reported to inhibit Ca2 + influx into cultured rat DRG neurons via Y2Rs (31, 32) and to inhibit release of SP from the terminals both in vitro and in vivo (19, 33).Spinally administered NPY induces antinociceptive effects (34) and biphasic effects on the nociceptive flexor reflex (35).Some species differences between rats and monkeys were observed in the present study.The Y1R is hardly synthesized normally in monkey DRGs or after Axo.However, the Y2R is expressed in small DRG neurons that often contain CGRP and SP in normal monkeys (36).Y2R occurs both in small and large neurons and this is more pronounced in monkey than in rat.This is in agreement with the results of a receptor binding study showing that Y2Rs are the main NPY binding sites in the superficial dorsal horn of the spinal cord of normal monkeys and after Axo (18).Thus, in the monkey local neurons in the superficial dorsal horn may therefore be the main source of NPY acting on the primary afferent terminals containing Y2Rs.The present study indicates that the Y2R normally is expressed only at very low levels in SCGs, suggesting that this presynaptic autoreceptor (6) is only of small functional significance, and that NPY released from sympathetic nerve endings may mainly act on postsynaptic receptors.Interestingly, no Y2R mRNA signal was observed in SPGs, which instead showed a low expression of Y1R mRNA in many neurons.Y2R mRNA was observed in sympathetic ganglia after Axo close to the cell bodies, in parallel with reduced NPY levels.NPY has been shown to contribute to peripheral hyperalgesia by acting on prejunctional Y2Rs on postganglionic sympathetic terminals (38), which could be present at high levels on sympathetic fibers regenerating after Axo.This may offer novel approaches to treatment of, for example, pain via agents acting on Y2Rs.Wahlestedt C, Yanaihara N, Hakanson R.Sheikh S P, Hakanson R, Schwartz T W.Herzog H, Hort Y J, Ball H J, Hayes G, Shine J, Selbie L A.J, He C, Branchek T A, Weinshank R L.Gehlert D R, Beavers L S, Johnson D, Gackenheimer S L, Schober D A, Gadski R A.Ghilardi J R, Allen C J, Vigna S R, McVey D C, Mantyh P W.Zhang X, Bao L, Xu Z Q, Jutta K, Arvidsson U, Elde R, Hokfelt T.Larhammar D, Ericsson A, Persson H.Amara S G, Arriza J L, Leff S E, Swanson L W, Evans R M, Rosenfeld M G.Ewald D A, Matthies H J G, Perney T M, Walker M W, Miller R J.Duggan A W, Hope P J, Lang C W.Zhang X, Ju G, Elde R, Hokfelt T.Tracey D J, Romm M A, Yao N N L.What happens if I save my password?Content of this nature is not necessarily prohibited on YouTube, however we will review this video and take action as appropriate.Per our Community Guidelines, hate speech is specifically defined in reference to "protected groups."Please refer to our Help Center for more information and the complete instructions.Thank you for sharing this video!Most people don't realize that Ayrton Senna was more popular in Brazil than Dale Earnhardt was in America; what a talent.Senna was a very special person and is nice to remember him.Would you like to comment?The code changes based on your selection.
|
